Treatments

The following database contains products that have been granted orphan status, or have been market approval in the EU or the USA.

You can filter the content by clicking on the titles: Product, Indication, Sponsor and Date. Clicking once, will filter the column alphabetically from A – Z and a second click on the same title will filter from Z – A.

Become a Partner.

Country Product Indication Sponsor Date
Celiprolol Ehlers-Danlos syndrome Acer Therapeutics, Inc.;222 Third Street, Suite 2240;Cambridge, Massachusetts, 02142 January 5, 2015
Pentosan polysulfate sodium Mucopolysaccharidosis type VI Plexcera Therapeutics, LLC;4445 North Highway A1A, Suite 241;Vero Beach, Florida, 32963 January 5, 2015
Antagonist of the endosomal Toll-like receptors (TLRs) 7, 8, and 9 Waldenstrom macroglobulinemia Idera Pharmaceuticals, Inc.;167 Sidney Street;Cambridge, Massachusetts, 02139 December 23, 2014
3-[2-(4-carbamimidoyl-phenylcarbamoyl)-5-methoxy-4-vinyl-phenyl]-6-(cyclopropylmethyl-carbamoyl)-pyridine-2-carboxylic acid Hereditary angioedema BioCryst Pharmaceuticals, Inc.;4505 Emperor Blvd, Suite 200200;Durham, North Carolina, 27703 December 23, 2014
OTL38; conjugate of pteroi acid and S0456 near infrared dye Ovarian cancer On Target Laboratories, LLC;1282 Win Hentschel Blvd;West Lafayette, Indiana, 47906 December 23, 2014
Oncolytic adenovirus coding for granulocyte macrophage colony stimulating factor (ONCOS-102) Malignant pleural mesothelioma Targovax OY;Saukonpaadenranta 2;Helsinki December 22, 2014
Chromium picolinate and chromium histidinate Pediatic polycystic ovary syndrome (0 through 16 years of age) JDS Therapeutics, LLC;3 Manhattanville Rd, Suite 201;Purchase, New York, 10577 December 22, 2014
Pleconaril Symptomatic enteroviral infection in the neonate AntiVirus Therapeutics, Inc.;7 Ardsley Ct.;Princeton, New Jersey, 08550 December 22, 2014
Entrectinib;N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide Neuroblastoma Ignyta, Inc.;4545 Towne Centre Court;San Diego, California, 92121 December 22, 2014
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide Neuroblastoma Ignyta, Inc.;11095 Flintkote Avenue, Suite D;San Diego, CA, 92121 December 22, 2014
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide Neuroblastoma Ignyta, Inc.;11095 Flintkote Avenue, Suite D;San Diego, CA, 92121 December 22, 2014
Docosahexaenoic acid, DHA Primary sclerosing cholangitis Sancilio and Company, Inc.;3874 Fiscal Ct., Suite 100;Riviera Beach, Florida, 33404 December 17, 2014
Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate Pancreatic Cancer PharmaCyte Biotech, Inc.;23046 Avenida de la Carlota, Suite 600;Laguna Hills, California, 92652 December 17, 2014
Adeno-associated viral vector serotype rh.10 carrying the human N-sulfoglucosamine sulfohydrolase cDNA Mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) LYSOGENE December 16, 2014
Ataluren Hurler syndrome PTC Therapeutics, Inc.;100 Corporate Court;South Plainfield, New Jersey, 07080 December 10, 2014
Imiquimod Carcinoma in situ (CIS) of the urinary bladder UroGen Pharma Ltd;9 Ha'Ta'asiya Street, P. O. Box 2397;Ra'anana December 3, 2014
1 8-(p[131I]-iodophenyl)octadecyl phosphocholine Multiple myeloma Cellectar Biosciences, Inc.;3301 Agriculture Drive;Madison, Wisconsin, 53716 December 3, 2014
Chimeric fusion protein of recombinant human alpha-N-acetylglucosaminidase and human insulin-like growth factor 2 Sanfilippo Syndrome BioMarin Pharmaceutical, Inc.;105 Digital Drive;Novato, California, 94949 November 25, 2014
225Ac-lintuzumab Acute myeloid leukemia Actinium Pharmaceuticals, Inc.;379 Thornall Avenue, 6th Floor;Edison, New Jersey, 08837 November 25, 2014
PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5’TCATCATTTTGTCATTTTGTCATT 3′ Rabies Mid-Atlantic BioTherapeutics, Inc.;3805 Old Easton Rd.;Doylestown, Pennsylvania, 18902 November 24, 2014
N-(2-amino-2-oxoethyl)-2-(2-((4-fluorophenethyl)amino)-N-isobutylacetamido)-N-(3-(2-oxopyrrolidin-1-yl)propyl)acetamide N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)propyl}-carbamoyl}-methyl)-2-[2-(2-fluorophenyl)-ethylamino]-N-isobutyl-acetamide Optic neuritis Bionure Farma SL;Dalmases 27, 08017;Barcelona November 17, 2014
N-(2-((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenamido)ethyl)-2-hydroxybenzamide Duchenne muscular dystrophy Catabasis Pharmaceuticals, Inc.;One Kendall Square, Suite B14202, Suite B14202;Cambridge, Massachusetts, 02139 November 17, 2014
N-(9-methoxynonyl)-1-deoxynojirimycin hydrochloride Acute dengue illness (inclusive of acute dengue illness, dengue fever, dengue hemorrhagic fever, and dengue shock syndrome) Emergent Virology, LLC;400 Professional Drive;Gaithersburg, Maryland, 20879 November 17, 2014
Edasalonexent Duchenne muscular dystrophy Catabasis Pharmaceuticals, Inc.;One Kendall Square, Suite B14202, Suite B14202;Cambridge, Massachusetts, 02139 November 17, 2014
Antagonist of the complement 5a receptor Atypical hemolytic uremic syndrome ChemoCentryx, Inc.;850 Maude Avenue;Mountain View, California, 94043 November 17, 2014