- Home
- /
- Treatment
- /
- Page 60
Treatments
The following database contains products that have been granted orphan status, or have been market approval in the EU or the USA.
You can filter the content by clicking on the titles: Product, Indication, Sponsor and Date. Clicking once, will filter the column alphabetically from A – Z and a second click on the same title will filter from Z – A.
Become a Partner.
| Country | Product | Indication | Sponsor | Date |
|---|---|---|---|---|
|
Celiprolol | Ehlers-Danlos syndrome | Acer Therapeutics, Inc.;222 Third Street, Suite 2240;Cambridge, Massachusetts, 02142 | January 5, 2015 |
|
Pentosan polysulfate sodium | Mucopolysaccharidosis type VI | Plexcera Therapeutics, LLC;4445 North Highway A1A, Suite 241;Vero Beach, Florida, 32963 | January 5, 2015 |
|
Antagonist of the endosomal Toll-like receptors (TLRs) 7, 8, and 9 | Waldenstrom macroglobulinemia | Idera Pharmaceuticals, Inc.;167 Sidney Street;Cambridge, Massachusetts, 02139 | December 23, 2014 |
|
3-[2-(4-carbamimidoyl-phenylcarbamoyl)-5-methoxy-4-vinyl-phenyl]-6-(cyclopropylmethyl-carbamoyl)-pyridine-2-carboxylic acid | Hereditary angioedema | BioCryst Pharmaceuticals, Inc.;4505 Emperor Blvd, Suite 200200;Durham, North Carolina, 27703 | December 23, 2014 |
|
OTL38; conjugate of pteroi acid and S0456 near infrared dye | Ovarian cancer | On Target Laboratories, LLC;1282 Win Hentschel Blvd;West Lafayette, Indiana, 47906 | December 23, 2014 |
|
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide | Neuroblastoma | Ignyta, Inc.;11095 Flintkote Avenue, Suite D;San Diego, CA, 92121 | December 22, 2014 |
|
Oncolytic adenovirus coding for granulocyte macrophage colony stimulating factor (ONCOS-102) | Malignant pleural mesothelioma | Targovax OY;Saukonpaadenranta 2;Helsinki | December 22, 2014 |
|
Pleconaril | Symptomatic enteroviral infection in the neonate | AntiVirus Therapeutics, Inc.;7 Ardsley Ct.;Princeton, New Jersey, 08550 | December 22, 2014 |
|
Chromium picolinate and chromium histidinate | Pediatic polycystic ovary syndrome (0 through 16 years of age) | JDS Therapeutics, LLC;3 Manhattanville Rd, Suite 201;Purchase, New York, 10577 | December 22, 2014 |
|
N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide | Neuroblastoma | Ignyta, Inc.;11095 Flintkote Avenue, Suite D;San Diego, CA, 92121 | December 22, 2014 |
|
Entrectinib;N-[5-(3,5-difluorobenzyl)-1H-indazol-3-yl]-4-(4-methylpiperazin-1yl)-2-(tetrahydro-2H-pyran-4-ylamino)benzamide | Neuroblastoma | Ignyta, Inc.;4545 Towne Centre Court;San Diego, California, 92121 | December 22, 2014 |
|
Docosahexaenoic acid, DHA | Primary sclerosing cholangitis | Sancilio and Company, Inc.;3874 Fiscal Ct., Suite 100;Riviera Beach, Florida, 33404 | December 17, 2014 |
|
Cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate | Pancreatic Cancer | PharmaCyte Biotech, Inc.;23046 Avenida de la Carlota, Suite 600;Laguna Hills, California, 92652 | December 17, 2014 |
|
Adeno-associated viral vector serotype rh.10 carrying the human N-sulfoglucosamine sulfohydrolase cDNA | Mucopolysaccharidosis type IIIA (Sanfilippo A syndrome) | LYSOGENE | December 16, 2014 |
|
Ataluren | Hurler syndrome | PTC Therapeutics, Inc.;100 Corporate Court;South Plainfield, New Jersey, 07080 | December 10, 2014 |
|
Imiquimod | Carcinoma in situ (CIS) of the urinary bladder | UroGen Pharma Ltd;9 Ha'Ta'asiya Street, P. O. Box 2397;Ra'anana | December 3, 2014 |
|
1 8-(p[131I]-iodophenyl)octadecyl phosphocholine | Multiple myeloma | Cellectar Biosciences, Inc.;3301 Agriculture Drive;Madison, Wisconsin, 53716 | December 3, 2014 |
|
Chimeric fusion protein of recombinant human alpha-N-acetylglucosaminidase and human insulin-like growth factor 2 | Sanfilippo Syndrome | BioMarin Pharmaceutical, Inc.;105 Digital Drive;Novato, California, 94949 | November 25, 2014 |
|
225Ac-lintuzumab | Acute myeloid leukemia | Actinium Pharmaceuticals, Inc.;379 Thornall Avenue, 6th Floor;Edison, New Jersey, 08837 | November 25, 2014 |
|
PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5’TCATCATTTTGTCATTTTGTCATT 3′ | Rabies | Mid-Atlantic BioTherapeutics, Inc.;3805 Old Easton Rd.;Doylestown, Pennsylvania, 18902 | November 24, 2014 |
|
(S)-3-((3-(1-((6-((3,4-dimethoxyphenyl)pryazin-2-yl)amino)ethyl)phenyl)carbamoyl)-5-methylpridin-1-ium | Pulmonary Arterial Hypertension | Pulmokine, Inc.;7 University Place, B127B;Rensselaer, New York, 12144 | November 17, 2014 |
|
(S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride | Inherited mitochondrial respiratory chain diseases | Khondrion BV;Philips van Leydenlaan 15, 6525 Ex Nijmegen; | November 17, 2014 |
|
Cannabidiol | Pediatric schizophrenia (pediatrics is defined as 0 through 16 years of age) | Insys Development Company, Inc.;1333 S. Spectrum Blvd, Suite 100;Chandler, Arizona, 85286 | November 17, 2014 |
|
N-(2-amino-2-oxoethyl)-2-(2-((4-fluorophenethyl)amino)-N-isobutylacetamido)-N-(3-(2-oxopyrrolidin-1-yl)propyl)acetamide N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)propyl}-carbamoyl}-methyl)-2-[2-(2-fluorophenyl)-ethylamino]-N-isobutyl-acetamide | Optic neuritis | Bionure Farma SL;Dalmases 27, 08017;Barcelona | November 17, 2014 |
|
N-(2-((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenamido)ethyl)-2-hydroxybenzamide | Duchenne muscular dystrophy | Catabasis Pharmaceuticals, Inc.;One Kendall Square, Suite B14202, Suite B14202;Cambridge, Massachusetts, 02139 | November 17, 2014 |
